Вич 1 клетка из 500

Вич 1 клетка из 500

Breast Milk from Tanzanian Women Has Divergent Effects on Cell-Free and Cell-Associated HIV-1 Infection In Vitro
Источник: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3429502/

Конкурирующие интересы: авторы заявили, что конкурирующих интересов не существует.

Задуманные и разработанные эксперименты: MAL ALH RIC. Проводили эксперименты: MLH MZ FVL. Проанализированы данные: MAL MLH FVL MZ ALH RIC. Используемые реагенты / материалы / инструменты анализа: MNM. Написал статью: MAL ALH RIC.

Текущий адрес: Отделение гематологии, Университет здоровья и смежных наук Мухимбили, Дар-эс-Салам, Танзания

Текущий адрес: Департамент здравоохранения, Каролинский институт, Стокгольм, Швеция

Передача ВИЧ-1 во время грудного вскармливания является важным источником новых педиатрических инфекций в странах Африки к югу от Сахары. Грудное молоко от ВИЧ-инфицированных матерей содержит как бесклеточный, так и клеточный вирус; однако влияние грудного молока на инфекционную инфекцию ВИЧ-1 остается плохо изученным. В настоящем исследовании грудное молоко было собрано у ВИЧ-инфицированных и ВИЧ-отрицательных женщин из Танзании, посещающих дородовые клиники в Дар-эс-Саламе. Молоко анализировали на активность in vitro против клеточного и клеточного ВИЧ-1. Мощное ингибирование безклеточного R5 и X4 ВИЧ-1 происходило в присутствии молока у всех доноров независимо от серостата ВИЧ-1. Ингибирование бесклеточной инфекции ВИЧ-1 положительно коррелировало с уровнями сиалил-LewisX в молоке у ВИЧ-положительных доноров. Напротив, молоко из 8 из 16 субъектов улучшало инфицирование клеточно-ассоциированным ВИЧ-1, независимо от донорского серостата. Молоко из двух из этих субъектов содержало высокие уровни множественных провоспалительных цитокинов, включая TNFα, IL-1β, IL-6, IL-8, MIP-1α, MIP-1β, MCP-1 и IP-10 и улучшенные клеточно- ассоциированной ВИЧ-1-инфекции при разведениях до 1:500. Эти данные показывают, что грудное молоко содержит врожденные факторы с дивергентной активностью против бесклеточного и клеточного ВИЧ-1 in vitro. Усиление ассоциированной с клеткой инфекции ВИЧ-1 грудным молоком может быть связано с воспалительными состояниями у матери и может способствовать младенческой инфекции во время грудного вскармливания.

Передача ВИЧ-1 от матери к ребенку во время грудного вскармливания обусловлена ​​наличием как бесклеточного вируса, так и ВИЧ-инфицированных клеток в молоке [1], [2]. Механизмы, связанные с передачей грудного молока ВИЧ-1, не совсем понятны; однако низкая распространенность инфекции среди большинства грудных детей грудного вскармливания ВИЧ-1 серопозитивных матерей предполагает, что передача ВИЧ-1 относительно неэффективна и поддерживает защитную роль для грудного молока в профилактике вирусной инфекции [3]. В клинических исследованиях компоненты в грудном молоке, включая IL-15 [4], жирные кислоты с длинной цепью [5] и эритропоэтин [6], были связаны с более низкими показателями послеродовой передачи ВИЧ-1. В in vitro муцин грудного молока (MUC1) эффективно блокирует связывание и передачу вируса из дендритных клеток (DC) в CD4 + T-клетки [7], [8] и ингибирует инфицирование ВИЧ-1 [9], [10]. Ингибирующее действие MUC1 объясняется богатым набором повторяющихся мотивов LewisX, что согласуется с прямой ролью LewisX в предотвращении связывания ВИЧ-1 с DC-SIGN [7], [8]. Олигосахариды молочного молока и гликаны, которые обильны в грудном молоке, представляют собой еще одну форму врожденного иммунитета против инфекции патогенами, включая ВИЧ-1 [11] — [13].

В среде грудного молока известно меньше о влиянии молочных факторов на связанный с клетками ВИЧ-1. В отличие от бесклеточной инфекции ВИЧ-1, связанная с клетками инфекция возникает из-за прямой передачи вируса в клетки к чувствительным клеткам-мишеням. Распространение клеток в клетке ВИЧ-1 в культуре значительно более эффективно, чем распространение бесклеточного вируса, и включает в себя формирование переходного, но сложного вирусологического синапса [14] — [17], который более трудно нейтрализовать [15] ,

Введение высокоактивной антиретровирусной терапии (ВААРТ) ВИЧ-инфицированным женщинам для профилактики передачи ВИЧ от матери ребенку (ППМР) во время грудного вскармливания связано с быстрым снижением уровня белковой ВИЧ-1 РНК в грудном молоке [ 18] и резкое сокращение передачи ВИЧ [19] — [23]. В клинических исследованиях ВААРТ по ППМР [19] — [21] сообщалось о скорости передачи менее 2%, что подтвердило эффективность этого вмешательства. Причина остаточной передачи ВИЧ-1 в этой ситуации не ясна; однако в недавних исследованиях были зафиксированы временные периоды виремии среди женщин, получающих ВААРТ для ППМР, на основе прерывистого обнаружения РНК ВИЧ-1 в материнской плазме и грудном молоке [24]. Наличие связанного с клеткой резервуара для ВИЧ-1 в грудном молоке также предлагается двумя независимыми клиническими исследованиями, подтверждающими стойкость провирусной ДНК в материнском молоке у женщин, получающих ВААРТ во время грудного вскармливания [18], [25]. В совокупности эти данные свидетельствуют о различных механизмах, которые определяют стойкость и инфекционность бесклеточного и клеточного ВИЧ-1 в грудном молоке.

В настоящем исследовании мы попытались оценить влияние грудного молока на инфицирование CD4 + клеток-мишеней клеточным и клеточным ВИЧ-1 in vitro. Наши результаты свидетельствуют о том, что грудное молоко может иметь различные действия против бесклеточного ВИЧ-1 по сравнению с клеточным вирусом, и это может иметь последствия для понимания патогенеза передачи ВИЧ-1 во время грудного вскармливания и установления ВААРТ для ППМР.

Протоколы для этого исследования были одобрены Институциональными комиссиями по обзору из Университета здравоохранения и смежных наук Мумимби (MUHAS, Дар-эс-Салам, Танзания) и Дартмутского колледжа (Ганновер, NH). Письменное информированное согласие было получено от всех доноров до сбора образцов молока.

Грудное молоко было получено у 20 женщин (10 ВИЧ-инфицированных и 10 ВИЧ-отрицательных), которые были зарегистрированы в женской клинике Национальной больницы Мухмибили (MNH) в Дар-эс-Саламе, Танзания, где проводятся обычные консультации и тестирование на ВИЧ-инфекцию. ВИЧ-положительные доноры молока были зачислены в клинику ППМР, которая связана с регулярной дородовой клиникой в ​​МНН. Информация о методах профилактики передачи ВИЧ-1 от матери к ребенку и варианты грудного вскармливания была предоставлена ​​ВИЧ-положительным донорам молока на консультациях по ППМР, проводимых медсестрой в клинике.

Чтобы иметь право на участие в исследовании, женщины должны были иметь здоровых детей грудного вскармливания без каких-либо трудностей. Матки грудного вскармливания с зарегистрированными признаками и симптомами мастита были исключены. Была получена история лечения и включалась информация о назначении однократной дозы невирапина (sdNVP) во время родов и / или АРВ-терапии, полученной в любое время до сдачи грудного молока.

Молоко собирали из левой или правой груди путем ручного самовыражения. Образцы собирали ≥1 ч после того, как младенец был последним грудью с назначенной стороны. Молоко собирали в стерильные пластиковые пробирки и немедленно хранили и перевозили при 4 ° С. Первоначальная обработка проводилась в лаборатории в МНН в течение 4 часов сбора. Цельное грудное молоко центрифугировали при 10000 × g в течение 10 минут, чтобы отделить осадок клеток от жидкой фазы молока. Осадок клеток промывали три раза, используя стерильный PBS и хранили при -80 ° C. Липидный слой молока удаляли вручную, а фракцию обезжиренного молока аликвотировали в 1 мл криовиализа и хранили при -80 ° C. Обезжиренное молоко и клеточные таблетки были отправлены на сухой лед в Медицинскую школу Гейзеля в Дартмуте для дальнейшего анализа. Перед использованием в экспериментах каждую аликвоту обезжиренного молока снова центрифугировали при 10000 × g в течение 5 мин для удаления остаточного липида и стерильной фильтрации через 0,20 микронный фильтр Millex-GV® (Millipore, Billerica, MA). Отдельные образцы молока не собирались для экспериментов.

Изоляты ВИЧ-1, используемые для этого исследования, включали штаммы с тропизмом для CCR5 (R5, HIV-1BaL) и CXCR4 (X4, HIV-1HC4). Вирусные запасы размножались в фитогемагглютининовых (PHA) -активированных мононуклеарных клетках периферической крови (РВМС) и титровали на клетках TZM-bl (NIH AIDS Research and Reference Reagent Program, которые были предоставлены доктором Джоном К. Каппесом, доктором Сяоюнь Ву и Транзимом, Inc.).

Влияние грудного молока на бесклеточную инфекцию ВИЧ-1 определяли путем измерения вирусной активации Tat-транскрипции ВИЧ-1 LTR и экспрессии люциферазы в клетках TZM-bl, как описано ранее [26]. Короче говоря, клетки TZM-bl высевали в 96-луночные планшеты с плотностью 1 × 104 клеток / лунку в 100 мкл среды модифицированного орла Dulbecco (DMEM), содержащей 1% фетальной бычьей сыворотки (FBS), антибиотиков и амфотерицина B. Бесклеточный ВИЧ-1 (100 TCID50) инкубировали с пятикратными серийными разведениями молока в течение 15 мин перед добавлением к клеткам TZM-bl. Каждый образец молока испытывали в трех лунках планшета. Клетки подвергали воздействию смеси молока и ВИЧ-1 в течение 24 часов при 37 ° С. После этой инкубации клетки промывали и оценивали на жизнеспособность с использованием раствора основанного на метане тиосульфонате (МТС) раствора (CellTiter 96® A), в соответствии с инструкциями производителя. Затем клетки лизировали и активность люциферазы измеряли в клеточных лизатах с использованием системы анализа люциферазы Bright-Glo ™ (Promega, WI). Активность люциферазы определяли количественно в относительных единицах света (RLU) с использованием люминометра LMaxII384 (Molecular Devices, Sunnyvale, CA). Определялась также активация линии люциферазы с помощью среды или только молока (в отсутствие добавленного ВИЧ-1). Процентное (%) ингибирование или усиление инфекции ВИЧ-1 рассчитывали по следующей формуле: 1 — ([RLU milk + HIV] — [только одно молоко RLU]) / ([RLU media + HIV] — [только среда RLU]) × 100%.

Для оценки влияния грудного молока на клеточно-ассоциированную инфекцию ВИЧ-1 ВИЧ-инфицированные CD4 + Т-лимфоциты периферической крови были совместно культивированы с клетками TZM-bl в присутствии или в отсутствие молока, как описано [26]. Затем уровни активности люциферазы определяли количественно как показатель инфицирования ВИЧ-1 клеток-мишеней TZM-bl. Вкратце, первичные CD4 + Т-лимфоциты сначала обогащали из РВМС и активировали в течение 48 часов с помощью PHA. Затем клетки промывали и ресуспендировали в свежих средах, содержащих 100 Е / мл интерлейкина-2 (IL-2), с последующим заражением ВИЧ-1 БАЛ в течение 5 дней при 37 ° С перед использованием. За один день до эксперимента клетки TZM-bl высевали в лунки 96-луночного планшета (1 × 104 клеток / лунку) и оставляли прилипать в течение ночи. В день эксперимента серийные разведения молока добавляли к указанным лункам клеток TZM-bl с последующим добавлением промытых ВИЧ-инфицированных CD4 + Т-лимфоцитов с конечной плотностью 1 × 105 лимфоцитов на лунку. Через 24 часа клетки лизировали непосредственно в лунках реагентом Beta-Glo (Promega, Madison WI) и количественную оценку активности люциферазы. Контроль включал клетки TZM-bl, совместно культивируемые с неинфицированными CD4 + Т-лимфоцитами в присутствии либо среды, либо молока. Кроме того, для борьбы с любым свободным от клеток ВИЧ-1, высвобождаемым из инфицированных лимфоцитов во время совместной культивирования, эквивалентное количество ВИЧ-инфицированных CD4 + лимфоцитов высевали в лунки в отсутствие клеток-мишеней TZM-bl. Супернатант из этих лунок, содержащий бесклеточный вирус, собирали через 24 часа и добавляли к клеткам TZM-bl. Также оценивали влияние грудного молока на инфекцию TZM-bl этим бесклеточным вирусом.

Уровни цитокинов, хемокинов и факторов роста в образцах грудного молока измеряли с использованием коммерчески доступных мультиплексных анализов (Bio-Rad Laboratories, Hercules, CA) в сочетании с основным фондом мониторинга иммунитета DartLab в Медицинской школе Гейзеля в Дартмуте. Результаты были количественно определены на основе индивидуальных стандартных кривых, генерируемых для каждого цитокина, и данных, проанализированных с использованием программного обеспечения Bio-Plex Manager ™. SDF-1α измеряли в грудном молоке с использованием коммерчески доступных ELISA (R & D Systems, Миннеаполис, MN) в соответствии с инструкциями производителя.

Измерение LewisX в грудном молоке осуществляли стандартным ELISA. Образцы молока разбавляли 1:10 в 0,2 М буфере NaHCO3, рН 9,6. Разведенные образцы (100 мкл / лунку) добавляли к пластинкам ELISA (пластины Maxisorp, Nunc) и инкубировали в течение ночи при 4 ° C. Планшеты трижды промывали буфером с трис-буферным раствором (TBS) / 0,05% Tween 20 [TBST]) и блокировали TBS / 1% BSA в течение 30 мин при комнатной температуре. После промывки TBST планшеты инкубировали с моноклональными антителами против человеческого человека LewisX IgM или мышиными антителами против человеческого человека (Calbiochem, San Diego, CA) в течение 2 часов при комнатной температуре с последующим промыванием TBST и детектированием с конъюгатом пероксидазы конъюгата IgM козьего антимышиного (Thermo Scientific / Pierce Biotechnology, Rockford, IL). После промывки для удаления несвязанных антител планшеты были разработаны с использованием реагента 1-Step ™ Turbo TMB-ELISA (Thermo Scientific / Pierce Biotechnology) при комнатной температуре. Реакцию останавливали через 30 мин добавлением 1 М H2SO4 и планшеты считывали на пластинчатом планшете ELISA при A450 нм.

ПЦР в реальном времени использовали для количественной оценки провирусной ДНК ВИЧ-1 в клеточных гранулах из отдельных образцов грудного молока. Полную клеточную геномную ДНК выделяли из гранул молочной клетки с использованием миниката крови Qiagen (Qiagen, Valencia CA). Затем образцы ДНК анализировали с помощью ПЦР в реальном времени для провирусной ДНК ВИЧ-1 с использованием праймеров и молекулярных маяков с широкой специфичностью для разных генотипов ВИЧ-1 [27]. Консервированные последовательности в генах gag HIV-1 амплифицировали с помощью праймеров gagF (5′-ATAATCCACCTATCCCAGTAGGAGAAAT-3 и gagR (5′-TTTGGTCCTTGTCTTATG TCCAGAATG-3 ‘) и детектировали с использованием молекулярного маяка HIV-1 / FAM, 5’GCGAGCCTGGGATTAAATAAAATAGTAAGAATGTATAGCGCTCGC- 3 ‘с гасителем DABCYL. Номер копии провирусной ДНК был количественно определен на основе стандартной кривой, полученной из 10-кратного серийного разведения (от 108 до 101 копий) плазмиды ВИЧ-1 с известным номером копии. Количество эквивалентов клеток было определено количественно путем амплификации последовательностей CCR5 с использованием праймеров CCR5-590 (5’-CTTCATCATCCTCCTGACAATCG-3 ‘) и CCR5rc890 (5′-GATTCCCGAGTAGCAGATGACC-3’) и молекулярного маяка CCR5 / FAM, CGAAGCTTGGGTGGTGGCTGTGTTTGCTTCG с гасителем DABCYL. Все реакции ПЦР переносились в двух экземплярах, в конечном объеме 50 мкл, с использованием HotStart-IT Probe для микширования в реальном времени для PCR (USB Corporation, Cleveland OH). Условия использования для CCR5 и количественного определения ВИЧ были денатурацией (95 ° С, 5 мин), а затем 45 циклов амплификации (95 ° С, 15 с; 50 ° С, 30 с; 72 ° C, 30 с) с использованием системы PCR Applied Biosystems 7300 в режиме реального времени.

GraphPad Prism v.4 (GraphPad Software, Inc, La Jolla, CA) использовался для расчета t-тестов и тестов Mann-Whitney U. Для выполнения групповых сравнений использовался односторонний и двухсторонний анализ дисперсии (ANOVA). Т-критерий ученика использовался для сравнения средних значений средней ошибки. Тест Mann-Whitney U использовался для сравнения медианного процента ингибирования ВИЧ-1 и концентрации цитокинов, присутствующих в молоке от ВИЧ-положительных и ВИЧ-отрицательных доноров. Корреляции Спирмена использовались для корреляции концентраций конкретных цитокинов и ингибирующей активности против бесклеточного ВИЧ-1. Для указания значимости использовалось р-значение ≤0,05.

Грудное молоко было получено от 20 ВИЧ-положительных и ВИЧ-отрицательных матерей, включенных в дородовую клинику в МНН. ВИЧ-инфицированные женщины регулярно посещали клинику ППМР, где получали консультации по стратегиям профилактики передачи ВИЧ-1 своим детям. Хотя ВИЧ-инфицированные женщины были зачислены в клинику ППМР, ни одно из них не сообщило о том, что принимало либо sdNVP, либо любую комбинацию АРВ-терапии. Они признали, что им предлагают лекарство при родах, но отказались принять его.

Женщины с клиническим маститом были исключены из исследования на основании физической оценки и конкретных вопросов о наличии боли, отек и выписки из груди. Обобщены характеристики доноров молока (таблица 1). Все образцы молока были получены у женщин в течение 42 дней после родов. Среди них образцы молозива были собраны в течение трех дней после родов от двух ВИЧ-позитивных и двух ВИЧ-отрицательных доноров. Среднее время послеродового сбора грудного молока у ВИЧ-положительных доноров (12,4 дня) было меньше, чем у ВИЧ-отрицательных доноров (19,3 дня); однако эта разница не была статистически значимой. Это различие, вероятно, связано с тщательным наблюдением за ВИЧ-инфицированными женщинами, включенными в клинику ППМР, по сравнению с здоровыми ВИЧ-отрицательными женщинами, у которых не было медицинских указаний на более частые последующие наблюдения.

Чтобы определить, влияет ли грудное молоко от ВИЧ-инфицированных женщин на бесклеточную инфекцию ВИЧ-1 in vitro, клетки TZM-bl были инфицированы R5 HIV-1BaL в присутствии пятикратных серийных разведений (от 1:41 до 1:2500 ) молока. Был оценен эффект зрелого молока от ВИЧ-положительных (n = 8) и ВИЧ-отрицательных (n = 8) доноров. Значительное ингибирование бесклеточного ВИЧ-1BaL наблюдалось с использованием молока как у ВИЧ-позитивных доноров (пунктирная линия), так и у ВИЧ-отрицательных доноров (сплошная линия), начинающихся с разведения 1:41 (рисунок 1). При этом разведении медианное процентное ингибирование ВИЧ-1 составляло 85% (диапазон 68% -90,5%) для ВИЧ-положительных доноров и 64% (от 61% до 75,5%) для ВИЧ-отрицательных доноров. Несмотря на тенденцию к большей ингибирующей активности, связанной с молоком у ВИЧ-позитивных доноров, по сравнению с ВИЧ-отрицательными донорами, эта разница не достигла статистической значимости. Ингибирующая активность грудного молока у всех доноров снижалась в прямой зависимости от дальнейшего разведения молока. Только минимальная ингибирующая активность наблюдалась при разведении 1:2500 с использованием молока от ВИЧ-инфицированных или ВИЧ-отрицательных доноров.

Злокачественное грудное молоко от ВИЧ-положительных (n = 8) и ВИЧ-негативных (n = 8) доноров оценивали на ингибирование бесклеточного ВИЧ-1 в анализах клеток TZM-bl. Клетки инфицировали R5 HIV-1BaL в присутствии пятикратных серийных разведений грудного молока. Процент ингибирования рассчитывали относительно контрольных культур, инфицированных ВИЧ-1BaL, в отсутствие добавленного грудного молока. Показана ВИЧ-ингибирующая активность грудного молока из ВИЧ-позитивных (пунктирная линия) и ВИЧ-негативных (сплошных линий) доноров (среднее ± SD).

Вместе эти результаты демонстрируют мощную ингибирующую активность ВИЧ-1 против клеток без содержания R5 ВИЧ-1 в зрелом молоке как у ВИЧ-инфицированных, так и у ВИЧ-отрицательных субъектов. Аналогичные результаты были получены против бесклеточного ВИЧ-1BaL с использованием образцов молозива, полученных от двух ВИЧ-положительных и двух ВИЧ-отрицательных доноров. По сравнению со зрелым молоком молозиво обладало более сильной ингибирующей активностью при разведении 1:500 (50% против 24%). Однако ингибирующая активность молозива значительно снижалась при разведении 1:2500, что было похоже на то, что наблюдалось для зрелого молока.

Были проведены дополнительные эксперименты для сравнения ингибирующей активности грудного молока с изолятами ВИЧ-1 с разным тропизмом. Индивидуальные образцы молока оценивали по штаммам ВИЧ-1 с R5-тропическим (ВИЧ-1BaL) и X4-тропическим (HIV-1HC4). Среди ВИЧ-положительных доноров ВИЧ-ингибирующая активность в грудном молоке составляла от 45 до 96% против ВИЧ-1BaL и от 25-94% против ВИЧ-1С4. В целом, молоко от каждого донора способно ингибировать оба штамма бесклеточного ВИЧ-1, и наблюдалась значительная корреляция между способностью ингибировать штаммы R5 и X4 (R2 = 0,596, p = 0,025).

Аналогичные результаты были обнаружены с использованием грудного молока у ВИЧ-отрицательных доноров, что свидетельствует о значительной корреляции между ингибирующей ВИЧ активностью против бесклеточного R5 и X4 ВИЧ-1 (R2 = 0,599, p = 0,024). Опять же, наблюдалась тенденция к более высокой ингибирующей активности среди образцов молока у ВИЧ-положительных доноров по сравнению с ВИЧ-негативными донорами, аналогичными нашим ранним наблюдениям (рис.1); однако эта разница не была статистически значимой.

Для трех ВИЧ-положительных доноров последовательные образцы грудного молока были получены на расстоянии 2 недели. При анализе активности, связанной с ВИЧ-инфекцией, молоко у 2 из 3-х доноров поддерживало постоянный уровень ингибирования безклеточного R5-ВИЧ-1BAL между первым и вторым временными точками, тогда как ингибирующая активность молока от третьего донора снижалась (данные не показано).

Далее мы исследовали, была ли ингибирующая ВИЧ активность грудного молока против бесклеточного ВИЧ-1 связана с увеличением концентрации лигандов для ко-рецепторов ВИЧ-1, CCR5 и CXCR4. Уровни MIP-1α, MIP-1β, RANTES и SDF-1α определяли количественно в молоке ВИЧ-положительных и ВИЧ-отрицательных субъектов. Концентрация молока MIP-1α была очень низкой в ​​большинстве испытуемых образцов, со средней концентрацией 42,1 пг / мл и 80,1 пг / мл для ВИЧ-положительных и ВИЧ-отрицательных доноров соответственно. Не было существенной разницы в среднем уровне MIP-1β (998,3 против 842,1 пг / мл, Mann-Whitney, p = 0,21) или RANTES (173,2 против 146,1 пг / мл, Mann-Whitney, p = 0,66), когда сравнивая образцы молока от ВИЧ-положительных против ВИЧ-отрицательных доноров. Средняя концентрация SDF-1α была значительно выше в молоке ВИЧ-положительных доноров по сравнению с ВИЧ-отрицательными донорами (1,525 против 1,189 пг / мл, Mann-Whitney, p = 0,009).

Чтобы определить, коррелируют ли уровни грудного молока MIP-1α, MIP-1β, RANTES или SDF-1 с ингибирующей активностью против бесклеточного ВИЧ-1 in vitro, концентрации каждого фактора сравнивали с процентом ВИЧ-ингибирования для того же образец. Корреляции Спирмена выполнялись для MIP-1α, MIP-1β, RANTES и SDF-1α и ингибирующей активности всех образцов молока как у ВИЧ-инфицированных, так и у ВИЧ-отрицательных доноров. Результаты этих сравнений не выявили существенной корреляции между уровнем MIP-1α, MIP-1β, RANTES или SDF-1α в молочной и бесклеточной ВИЧ-ингибирующей активности для всех доноров, независимо от серостата ВИЧ-1. Кроме того, не было никакой корреляции между концентрацией MIP-1α, MIP-1β, RANTES или SDF-1α в молоке и процентной ингибирующей активностью против бесклеточного ВИЧ-1 при сравнении ВИЧ-положительных и ВИЧ-отрицательных доноров в отдельных анализах ,

Грудное молоко как у ВИЧ-инфицированных, так и у ВИЧ-отрицательных доноров дополнительно оценивалось на наличие расширенного диапазона цитокинов, хемокинов и факторов роста с использованием мультиплексной панели. Среди образцов молока у всех доноров наблюдалось значительное изменение в диапазоне концентраций измеряемых факторов (рис. 2). В частности, IL-6, IL-8, MIP-1α, MIP-1β, MCP-1 и IP-10 имели ≥1 log-вариацию среди доноров. Следует отметить, что субъект 002+ (ВИЧ-положительный) и субъект 002- (ВИЧ-отрицательный) отличался значительно более высокой концентрацией множественных воспалительных факторов, включая TNFα, IL-1β, IL-6, IL-8, MIP-1α , MIP-1β, MCP-1 и IP-10 в молоке по сравнению с другими донорами. Никаких существенных различий в уровнях индивидуальных иммунных факторов среди образцов молока у ВИЧ-положительных и ВИЧ-отрицательных доноров не наблюдалось, и не было обнаружено существенных корреляций между уровнем индивидуальных цитокинов в молоке и ингибированием бесклеточного ВИЧ-1.

Концентрации множественных иммунных факторов, включая цитокины, хемокины и факторы роста, измеряли в образцах грудного молока с использованием мультиплексной панели. Данные для каждого фактора выражаются как концентрация (пг / мл) и представлены для всех доноров независимо от серостата ВИЧ.

Предыдущие исследования показали роль антигена группы крови LewisX в блокировании взаимодействия между HIV-1gp120 и DC-SIGN, выраженным в дендритных клетках (DC) [8]. Аналогично, MUC1, полученный из эпителия в грудном молоке, который содержит несколько повторяющихся мотивов LewisX, был вовлечен в предотвращение бесклеточной передачи ВИЧ-1 в DC и инфицирование CD4 + T-клеток [8] — [10]. В настоящем исследовании уровни LewisX и сиалил-LewisX измерялись в грудном молоке танзанийских доноров. Результаты демонстрируют присутствие как LewisX, так и сиалил-LewisX в молоке всех доноров с четкой кластеризацией низкоуровневых выражений у отдельных доноров (рис. 3). По сравнению с ВИЧ-ингибирующей активностью против бесклеточного R5- или X4-тропического вируса не было обнаружено корреляции между уровнями молока LewisX или сиалил-LewisX среди ВИЧ-отрицательных доноров или уровнями LewisX среди ВИЧ-положительных доноров (рис. 3A-C). Тем не менее, значительная корреляция наблюдалась среди ВИЧ-положительных доноров между уровнями сиалил-LewisX в молочной и бесклеточной ВИЧ-ингибирующей активности (R2 = 0,657) (рис. 3D). Эти результаты подтверждают возможную роль сиалил-LewisX в грудном молоке в предотвращении бесклеточной инфекции ВИЧ-1 восприимчивых клеток CD4 +-мишени.

Уровни LewisX и sialyl-LewisX измеряли с помощью ELISA в образцах грудного молока как у ВИЧ-инфицированных, так и у ВИЧ-отрицательных доноров. Затем результаты сравнивали с клеточной активностью по ингибированию ВИЧ для тех же образцов. Данные выражают как процентное ингибирование безклеточного R5 (□) и X4 (♦) ВИЧ-1 по отношению к уровням LewisX или сиалил-LewisX, измеренным для каждого образца.

В дальнейших экспериментах мы оценивали способность грудного молока ингибировать клеточно-ассоциированную инфекцию ВИЧ-1 in vitro. Эффект молока при разведениях 1:41, 1:20, 1:100 и 1:500 оценивали в клетках TZM-bl, совместно культивируемых с ВИЧ-инфицированными первичными CD4 + Т-лимфоцитами. В отличие от наших результатов с использованием бесклеточного вируса, ингибирование клеточного ВИЧ-1 наблюдалось с молоком только у 2 из 16 доноров, а затем только при самом низком разведении (1:41) (рисунок 4). Более того, значительное увеличение связанной с клетками инфекции ВИЧ-1 наблюдалось в присутствии молока как у ВИЧ-инфицированных, так и у ВИЧ-отрицательных доноров. Даже при разведениях, достигающих 1:500, молоко от двух доноров, субъект 002+ (ВИЧ-положительный) и субъект 002- (ВИЧ-отрицательный), значительно улучшали клеточную инфекцию ВИЧ-1 (рис.4). Как отмечалось ранее, молоко у этих доноров имело значительно более высокие уровни множественных воспалительных факторов. Не обнаружено корреляции между уровнями LewisX или сиалил-LewisX в образцах молока и наблюдаемой повышающей активностью против клеточного ВИЧ-1 (данные не показаны), что указывает на то, что отдельные факторы влияют на влияние грудного молока на бесклеточную по сравнению с клеткой -связанный вирус.

Грудное молоко от ВИЧ-положительных и ВИЧ-отрицательных доноров оценивали на активность против клеточной ВИЧ-1 инфекции в тестах клеток TZM-bl. Грудное молоко тестировали в 5-кратных серийных разведениях (1:41, 1:20, 1:100 и 1:500). Процент ингибирования или усиления связанного с клеткой R5 ВИЧ-1BAL показан для образцов грудного молока у отдельных ВИЧ-положительных (открытых кругов) и ВИЧ-негативных (закрытых кругов) доноров.

Чтобы определить, связано ли увеличение клеточной ВИЧ-инфекции от грудного молока in vitro с присутствием ВИЧ-инфицированных клеток in vivo, мы использовали количественную ПЦР в реальном времени для оценки провирусной нагрузки в клетках грудного молока, выделенных из ВИЧ-1-положительного доноров в этом исследовании. Провирусную ДНК ВИЧ-1 определяли ПЦР в реальном времени в 4 из 9 тестируемых доноров. Из этих доноров с детектируемой провирусной ДНК в клетках грудного молока у 3 из 4 было обнаружено грудное молоко, которое значительно улучшало клеточную ВИЧ-1-инфекцию in vitro.

Результаты этого исследования демонстрируют значительное ингибирование бесклеточного ВИЧ-1 грудным молоком как у ВИЧ-инфицированных, так и у ВИЧ-отрицательных женщин из Танзании. Ингибирование бесклеточного вируса в значительной степени не зависело от вирусного тропизма; однако наблюдалась тенденция к более высоким уровням ингибирования бесклеточного ВИЧ-1 с молоком от ВИЧ-положительных по сравнению с ВИЧ-отрицательными субъектами, предполагая, что как врожденные, так и адаптивные иммунные факторы могут способствовать общему антивирусному эффекту молоко.

Ранее мы обнаружили, что грудное молоко от ВИЧ-отрицательных доноров в Соединенных Штатах сильно ингибирует бесклеточную ВИЧ-1-инфекцию in vitro, что свидетельствует о наличии врожденных антивирусных факторов при относительно высоком содержании в грудном молоке [26]. Здесь мы подтверждаем ингибирующее действие грудного молока на бесклеточный ВИЧ-1, используя образцы, полученные как от ВИЧ-инфицированных, так и от ВИЧ-отрицательных женщин из Африки к югу от Сахары. Антивирусная активность против бесклеточного ВИЧ-1 не коррелировала с присутствием или уровнем отдельных цитокинов, хемокинов или факторов роста в молоке, включая факторы, которые служат блокирующим лигандом для ко-рецепторов ВИЧ-1, CCR5 и CXCR4.

Однако была обнаружена корреляция между активностью по ингибированию ВИЧ и сиалированной формой антигена группы крови LewisX в молоке ВИЧ-позитивных женщин. Показано, что LewisX и MUC1, выделенные из грудного молока, ингибируют связывание безклеточного ВИЧ-1 с DC-SIGN и предотвращают передачу инфекции в CD4 + T-клетки [8] — [10]. Наблюдаемая корреляция между ингибирующей активностью грудного молока против бесклеточного ВИЧ-1 и уровнями сиалил-LewisX в молоке свидетельствует о том, что остатки сиаловой кислоты могут играть ключевую роль в блокировании бесклеточной вирусной инфекции. Было показано, что наличие мотивов сиаловой кислоты на концах боковых цепей углеводов значительно снижает присущую инфекционность как SIV, так и HIV-1 [28], [29], в то время как переваривание нейраминдазой, которая расщепляет сиалильные фрагменты, усиливает вирусную инфективность и повышает клеточно-клеточное образование синцития in vitro
[28].

Несмотря на обнаружение сильной ингибирующей активности против бесклеточного ВИЧ-1, грудное молоко у одних и тех же субъектов не оказывало ингибирующего влияния на клеточную ВИЧ-инфекцию in vitro. Скорее, значительная доля молока от отдельных доноров, включая как ВИЧ-инфицированных, так и ВИЧ-отрицательных субъектов, повысила уровень связанной с клетками инфекции ВИЧ-1. Усиление не коррелировало с уровнями сиалил-LewisX в молоке или с наличием отдельных цитокинов или хемокинов, что указывает на то, что отдельные факторы в грудном молоке модулируют клеточную или клеточную ВИЧ-1-инфекцию.

Усиление взаимодействия клеток-клеток и ВИЧ-1 в присутствии грудного молока может быть результатом повышения регуляции молекул клеточной поверхности, необходимых для эффективного прикрепления и взаимодействия ВИЧ-инфицированных молочных клеток с целью нацеливания клеток в кишечном эпителии или подслизистой ткани. Формирование вирусологического синапса между ВИЧ-инфицированными и неинфицированными клетками характеризуется плотным адгезионным связыванием, связанным с связыванием ВИЧ-1 gp120 с CD4 и взаимодействием мембран с молекулами адгезии, включая ICAM-1 [30]. Грудное молоко содержит высокие уровни растворимого ICAM-1 (sICAM-1), который может ингибировать клеточную клеточную адгезию и модулировать клеточно-ассоциированную инфекцию ВИЧ-1. Мы измерили уровни sICAM-1 в молоке субъектов в этом исследовании и обнаружили диапазон концентраций (фиг.2A), но не коррелировали с ингибированием или усилением связанной с клеткой инфекции ВИЧ-1. В более ранних исследованиях не сообщалось о блокировании антител против ICAM-1 в предотвращении адгезии ВИЧ-инфицированных лимфоцитарных клеток к эпителиальным клеткам [31], [32], предполагая, что другие молекулы имеют решающее значение для формирования плотного адгезивного соединения в этой обстановке.

Альтернативно, активация экспрессии ВИЧ-1 из латентно инфицированных клеток и / или повышенное высвобождение вирионов в синаптическую расщелину может стимулироваться наличием стимулирующих факторов в грудном молоке. Связанный с клетками ВИЧ-1 в грудном молоке встречается в основном у инфицированных CD4 + Т-лимфоцитов и макрофагов [33] — [35]. При стимуляции in vitro ВИЧ-инфицированные молочные клетки выделяют более высокий уровень вируса, чем сопоставимая популяция клеток из периферической крови [35]. Было показано, что активированные молочные CD4 + Т-клетки у женщин, получающих ВААРТ, продуцируют ВИЧ-1 in vitro, что указывает на то, что эти клетки могут представлять собой резервуар, который является относительно преломляющим для лечения [36].

Известно, что активация транскрипции ВИЧ-1 модулируется иммунными цитокинами [37], и возможно, что высокий уровень воспалительных факторов в грудном молоке может сыграть определенную роль в увеличении выделения ВИЧ-1 из инфицированных клеток. Среди испытуемых в этом исследовании в молоке у двух испытуемых наблюдались заметно повышенные концентрации множественных воспалительных факторов, а молоко у этих субъектов также усиливало инфицирование клеточно-ассоциированным ВИЧ-1 при разведениях до 1:500 (самое высокое испытание на разбавление) ,

Известно, что воспалительные состояния в молочной железе, включая мастит, повышают риск передачи ВИЧ-1 во время грудного вскармливания [38] — [40]. Матерям в этом исследовании подвергали скринингу при зачислении, а те, у кого были клинические признаки и симптомы мастита, были исключены. Однако субклинический мастит может также увеличить уровни воспалительных факторов в грудном молоке. Исследования Kantarci и др. [41] обнаружили положительную корреляцию между субклиническим маститом, увеличенными соотношениями Na / K молока и большим числом ВИЧ-инфицированных клеток в молоке у ВИЧ-инфицированных матерей Танзании, которые передавали ВИЧ-1 своим грудным детям через грудное вскармливание. Несмотря на то, что наши результаты свидетельствуют о том, что воздействие ВИЧ-инфицированных клеток in vitro на грудное молоко, содержащее высокие уровни множественных воспалительных факторов, может значительно повысить клеточно-ассоциированную инфекцию ВИЧ-1.

Дальнейшие исследования необходимы для определения механизмов усиления клеточной ВИЧ-1-инфекции у грудного молока. Локальные и системные воспалительные реакции у матери могут способствовать увеличению уровней провоспалительных факторов в молоке. Среди ВИЧ-инфицированных матерей это может представлять повышенный риск передачи вируса во время грудного вскармливания. Более того, отказ грудного молока блокировать связанный с клеткой ВИЧ-1 может быть связан с поддержанием клеточного резервуара вируса в грудном молоке и может способствовать остаточной передаче ВИЧ-1 грудным детям грудного возраста среди женщин, получающих ВААРТ во время лактации.

Авторы хотели бы поблагодарить Карин Мецнер за очень полезную помощь и рекомендации с количественными анализами ПЦР в реальном времени, а также Стефани Дороско, Сусаной Асин, Кристиан Ролленхаген, Чарльз Вира, Пол Гир, Пол Палумбо и Эндрю Даубенспек за полезные научные обсуждения и советы экспертов во время ход этой работы, и С. Форд фон Рейн и Ричард Уодделл за постоянную поддержку и руководство через AITRP Дартмут-Фогарти. Мы благодарим врачей и медсестер в Национальной больнице Мухимбили, Университете здоровья и смежных наук Мухимбили и клиниках ППМР в Дар-эс-Саламе, Танзания. Мы особенно благодарим танзанийских матерей, которые пожертвовали грудное молоко для этого исследования.



Source: rupubmed.com


Добавить комментарий